Review



mucin 2  (Bioss)


Bioz Verified Symbol Bioss is a verified supplier
Bioz Manufacturer Symbol Bioss manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Bioss mucin 2
    Mucin 2, supplied by Bioss, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mucin 2/product/Bioss
    Average 94 stars, based on 3 article reviews
    mucin 2 - by Bioz Stars, 2026-03
    94/100 stars

    Images



    Similar Products

    96
    Thermo Fisher mucin 2
    Mucin 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mucin 2/product/Thermo Fisher
    Average 96 stars, based on 1 article reviews
    mucin 2 - by Bioz Stars, 2026-03
    96/100 stars
      Buy from Supplier

    94
    Bioss mucin 2
    Mucin 2, supplied by Bioss, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mucin 2/product/Bioss
    Average 94 stars, based on 1 article reviews
    mucin 2 - by Bioz Stars, 2026-03
    94/100 stars
      Buy from Supplier

    96
    Thermo Fisher anti human mucin 2
    Anti Human Mucin 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti human mucin 2/product/Thermo Fisher
    Average 96 stars, based on 1 article reviews
    anti human mucin 2 - by Bioz Stars, 2026-03
    96/100 stars
      Buy from Supplier

    95
    Vector Laboratories mucin stain
    Mucin Stain, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mucin stain/product/Vector Laboratories
    Average 95 stars, based on 1 article reviews
    mucin stain - by Bioz Stars, 2026-03
    95/100 stars
      Buy from Supplier

    96
    Proteintech mucin 2 muc2
    Mucin 2 Muc2, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mucin 2 muc2/product/Proteintech
    Average 96 stars, based on 1 article reviews
    mucin 2 muc2 - by Bioz Stars, 2026-03
    96/100 stars
      Buy from Supplier

    96
    Thermo Fisher mucin 2 muc2
    Expression of differentiation markers and CYP genes in duodenal organoids under differentiation conditions. Five differentiation markers, alkaline phosphatase ( ALP ), CgA , leucine-rich repeat-containing G-protein coupled receptor 5 ( Lgr5 ), lysozyme ( Lyz ), and <t>mucin</t> <t>2</t> ( <t>MUC2</t> ), as well as 2 CYP genes, CYP2B11 and CYP3A98 mRNA, were quantified using RT-qPCR. Two biological replicates (dog 1 and dog 3) were used for this analysis, and differentiation/nondifferentiation treatment was replicated 3 times. The error bars represent the SD. ∗ P < .05; ∗∗ P < .01. NS, not significant.
    Mucin 2 Muc2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mucin 2 muc2/product/Thermo Fisher
    Average 96 stars, based on 1 article reviews
    mucin 2 muc2 - by Bioz Stars, 2026-03
    96/100 stars
      Buy from Supplier

    96
    Proteintech mucin 2 muc2 polyclonal antibody
    Effects of terpine-4-ol on the number of goblet cells, the protein expression of <t>mucin</t> <t>2</t> <t>(Muc2)</t> and chromogranin A (ChgA) in the small intestine of immune-stressed piglets. The goblet cells in the jejunum and ileum (A, B). The immunohistochemical staining of Muc2 in the jejunum and ileum (C). The immunohistochemical staining of ChgA in the jejunum and ileum (D). CON, control group; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group. Different small letters above data columns indicate significant differences among different groups ( P < 0.05).
    Mucin 2 Muc2 Polyclonal Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mucin 2 muc2 polyclonal antibody/product/Proteintech
    Average 96 stars, based on 1 article reviews
    mucin 2 muc2 polyclonal antibody - by Bioz Stars, 2026-03
    96/100 stars
      Buy from Supplier

    97
    Thermo Fisher intestinal alpi ttcctggtgtccccacttcg tcctcagctgggatgacgc mucin 2 muc2 cagcaccgattgctgagttg gctggtcatctcaatggcag 186 edu proliferation assay
    Effects of terpine-4-ol on the number of goblet cells, the protein expression of <t>mucin</t> <t>2</t> <t>(Muc2)</t> and chromogranin A (ChgA) in the small intestine of immune-stressed piglets. The goblet cells in the jejunum and ileum (A, B). The immunohistochemical staining of Muc2 in the jejunum and ileum (C). The immunohistochemical staining of ChgA in the jejunum and ileum (D). CON, control group; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group. Different small letters above data columns indicate significant differences among different groups ( P < 0.05).
    Intestinal Alpi Ttcctggtgtccccacttcg Tcctcagctgggatgacgc Mucin 2 Muc2 Cagcaccgattgctgagttg Gctggtcatctcaatggcag 186 Edu Proliferation Assay, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/intestinal alpi ttcctggtgtccccacttcg tcctcagctgggatgacgc mucin 2 muc2 cagcaccgattgctgagttg gctggtcatctcaatggcag 186 edu proliferation assay/product/Thermo Fisher
    Average 97 stars, based on 1 article reviews
    intestinal alpi ttcctggtgtccccacttcg tcctcagctgggatgacgc mucin 2 muc2 cagcaccgattgctgagttg gctggtcatctcaatggcag 186 edu proliferation assay - by Bioz Stars, 2026-03
    97/100 stars
      Buy from Supplier

    Image Search Results


    Expression of differentiation markers and CYP genes in duodenal organoids under differentiation conditions. Five differentiation markers, alkaline phosphatase ( ALP ), CgA , leucine-rich repeat-containing G-protein coupled receptor 5 ( Lgr5 ), lysozyme ( Lyz ), and mucin 2 ( MUC2 ), as well as 2 CYP genes, CYP2B11 and CYP3A98 mRNA, were quantified using RT-qPCR. Two biological replicates (dog 1 and dog 3) were used for this analysis, and differentiation/nondifferentiation treatment was replicated 3 times. The error bars represent the SD. ∗ P < .05; ∗∗ P < .01. NS, not significant.

    Journal: Drug Metabolism and Disposition

    Article Title: Canine duodenal organoids as a functional platform for intestinal CYP regulation and drug metabolism studies

    doi: 10.1016/j.dmd.2025.100191

    Figure Lengend Snippet: Expression of differentiation markers and CYP genes in duodenal organoids under differentiation conditions. Five differentiation markers, alkaline phosphatase ( ALP ), CgA , leucine-rich repeat-containing G-protein coupled receptor 5 ( Lgr5 ), lysozyme ( Lyz ), and mucin 2 ( MUC2 ), as well as 2 CYP genes, CYP2B11 and CYP3A98 mRNA, were quantified using RT-qPCR. Two biological replicates (dog 1 and dog 3) were used for this analysis, and differentiation/nondifferentiation treatment was replicated 3 times. The error bars represent the SD. ∗ P < .05; ∗∗ P < .01. NS, not significant.

    Article Snippet: We quantified a variety of lineage-specific marker genes, including alkaline phosphatase for epithelial cells, CgA for enteroendocrine cells, leucine-rich repeat-containing G-protein coupled receptor 5 ( Lgr5 ) for stem cells, lysozyme ( Lyz ) for Paneth cells, and mucin 2 ( MUC2 ) for goblet cells, as well as drug-responsive genes ( CYP2B11 , CYP3A98 , CAR , and PXR ), using RT-qPCR on days 4, 6, and 8 with SYBR Green (Thermo Fisher Scientific) and a CFX96 system (Bio-Rad) following established protocols., , , , , , , GAPDH , HMBS , and SDHA served as reference genes.

    Techniques: Expressing, Quantitative RT-PCR

    Effects of terpine-4-ol on the number of goblet cells, the protein expression of mucin 2 (Muc2) and chromogranin A (ChgA) in the small intestine of immune-stressed piglets. The goblet cells in the jejunum and ileum (A, B). The immunohistochemical staining of Muc2 in the jejunum and ileum (C). The immunohistochemical staining of ChgA in the jejunum and ileum (D). CON, control group; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group. Different small letters above data columns indicate significant differences among different groups ( P < 0.05).

    Journal: Animal Nutrition

    Article Title: Terpine-4-ol alleviates lipopolysaccharide-induced intestinal injury in weaned piglets by regulating intestinal epithelial cell homeostasis via the Wnt/β-catenin signaling pathway

    doi: 10.1016/j.aninu.2024.12.010

    Figure Lengend Snippet: Effects of terpine-4-ol on the number of goblet cells, the protein expression of mucin 2 (Muc2) and chromogranin A (ChgA) in the small intestine of immune-stressed piglets. The goblet cells in the jejunum and ileum (A, B). The immunohistochemical staining of Muc2 in the jejunum and ileum (C). The immunohistochemical staining of ChgA in the jejunum and ileum (D). CON, control group; LPS, lipopolysaccharide challenged group; LTP, low dose of terpine-4-ol supplemented group; MTP, middle dose of terpine-4-ol supplemented group; HTP, high dose of terpine-4-ol supplemented group. Different small letters above data columns indicate significant differences among different groups ( P < 0.05).

    Article Snippet: The sections were incubated with the first primary antibodies of antigen Ki-67 (Ki-67) polyclonal antibody (1:400, PA5-19462, Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), chromogranin A antibody (1:2, ab53464, Abcam, Cambridge, UK), mucin 2 (Muc2) polyclonal antibody (1:1500, 27675-1-AP, Proteintech Group, Rosemont, IL, USA), villin polyclonal antibody (1:100, ab233155, Abcam, Cambridge, UK), cleaved caspase 3 antibody (1:2200, 9664S, Cell Signaling Technology, Danvers, MA, USA) for 1 h at room temperature, respectively.

    Techniques: Expressing, Immunohistochemical staining, Staining, Control